|
ATCC
caption a7 organism phylum identity Caption A7 Organism Phylum Identity, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 organism phylum identity/product/ATCC Average 96 stars, based on 1 article reviews
caption a7 organism phylum identity - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
caption a7 source organism unknown dna source unknown forward primer † gene specific att b1 primer ![]() Caption A7 Source Organism Unknown Dna Source Unknown Forward Primer † Gene Specific Att B1 Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 source organism unknown dna source unknown forward primer † gene specific att b1 primer/product/Thermo Fisher Average 99 stars, based on 1 article reviews
caption a7 source organism unknown dna source unknown forward primer † gene specific att b1 primer - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc ![]() Caption A7 Source Organism J Denitrificans Strain Atcc 14870 Dna Source Synthetic Dna Forward Primer 5 Ccgtagcaat Ggatcc Atgaagaagagaaagttgagagcgtcagc, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc/product/ATCC Average 93 stars, based on 1 article reviews
caption a7 source organism j denitrificans strain atcc 14870 dna source synthetic dna forward primer 5 ccgtagcaat ggatcc atgaagaagagaaagttgagagcgtcagc - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
ATCC
t5 caption a7 test organism mic ic 50 sem ![]() T5 Caption A7 Test Organism Mic Ic 50 Sem, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/t5 caption a7 test organism mic ic 50 sem/product/ATCC Average 99 stars, based on 1 article reviews
t5 caption a7 test organism mic ic 50 sem - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 source organism s mutans dna source s mutans strain ua159 ![]() Caption A7 Source Organism S Mutans Dna Source S Mutans Strain Ua159, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 source organism s mutans dna source s mutans strain ua159/product/ATCC Average 98 stars, based on 1 article reviews
caption a7 source organism s mutans dna source s mutans strain ua159 - by Bioz Stars,
2026-03
98/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 organism atcc no ![]() Caption A7 Organism Atcc No, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 organism atcc no/product/ATCC Average 99 stars, based on 1 article reviews
caption a7 organism atcc no - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 organism antifungal agent mic range ![]() Caption A7 Organism Antifungal Agent Mic Range, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 organism antifungal agent mic range/product/ATCC Average 99 stars, based on 1 article reviews
caption a7 organism antifungal agent mic range - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Signal Recovery
whole-organ mean signal recovery ![]() Whole Organ Mean Signal Recovery, supplied by Signal Recovery, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/whole-organ mean signal recovery/product/Signal Recovery Average 90 stars, based on 1 article reviews
whole-organ mean signal recovery - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 organism amp lib 16a 17a l7b s aureus atcc 29213 sensitive 4 128 128 128 128 s aureus nctc 12493 mec a resistant ![]() Caption A7 Organism Amp Lib 16a 17a L7b S Aureus Atcc 29213 Sensitive 4 128 128 128 128 S Aureus Nctc 12493 Mec A Resistant, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 organism amp lib 16a 17a l7b s aureus atcc 29213 sensitive 4 128 128 128 128 s aureus nctc 12493 mec a resistant/product/ATCC Average 99 stars, based on 1 article reviews
caption a7 organism amp lib 16a 17a l7b s aureus atcc 29213 sensitive 4 128 128 128 128 s aureus nctc 12493 mec a resistant - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
Millipore
pet-28b(+) vector ![]() Pet 28b(+) Vector, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pet-28b(+) vector/product/Millipore Average 90 stars, based on 1 article reviews
pet-28b(+) vector - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 source organism s epidermidis atcc 12228 ![]() Caption A7 Source Organism S Epidermidis Atcc 12228, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 source organism s epidermidis atcc 12228/product/ATCC Average 99 stars, based on 1 article reviews
caption a7 source organism s epidermidis atcc 12228 - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
ATCC
caption a7 source organism s oralis ![]() Caption A7 Source Organism S Oralis, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/caption a7 source organism s oralis/product/ATCC Average 97 stars, based on 1 article reviews
caption a7 source organism s oralis - by Bioz Stars,
2026-03
97/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Acta Crystallographica. Section F, Structural Biology Communications
Article Title: The structure of a glycoside hydrolase 29 family member from a rumen bacterium reveals unique, dual carbohydrate-binding domains
doi: 10.1107/S2053230X16014072
Figure Lengend Snippet: Macromolecule-production information
Article Snippet: The protein was concentrated (at room temperature) using a 10 kDa molecular-weight cutoff ultrafiltration centrifugation column (Sartorius, Germany), further purified by gel filtration on a S200 16/60 size-exclusion column (GE Healthcare, Germany) in 50 m M Tris pH 7.5, 100 m M NaCl buffer and concentrated. table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Clone Assay, Plasmid Preparation, Expressing, Sequencing, Construct, Produced
Journal: Acta Crystallographica. Section F, Structural Biology Communications
Article Title: Neutron and high-resolution room-temperature X-ray data collection from crystallized lytic polysaccharide monooxygenase
doi: 10.1107/S2053230X15019743
Figure Lengend Snippet: Macromolecule-production information
Article Snippet: Details of the cloning and protein-production procedures are summarized in Table 1 . table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Expressing, Plasmid Preparation, Sequencing, Construct, Produced
Journal: Acta Crystallographica. Section F, Structural Biology Communications
Article Title: Crystal structure of the aromatic-amino-acid aminotransferase from Streptococcus mutans
doi: 10.1107/S2053230X18018472
Figure Lengend Snippet: Macromolecule-production information
Article Snippet: Macromolecule-production information is summarized in Table 1 . table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Cloning, Plasmid Preparation, Expressing, Sequencing, Construct, Produced
Journal: Molecular imaging and biology
Article Title: The Impact of Positron Range on PET Resolution, Evaluated with Phantoms and PHITS Monte Carlo Simulations for Conventional and Non-conventional Radionuclides
doi: 10.1007/s11307-019-01337-2
Figure Lengend Snippet: Simulation organ volumes, organ uptake values from Holland et al. used in simulations, and corresponding organ-level mean signal recovery in the modified Digimouse phantom, for different radionuclides
Article Snippet: Note in particular the poor quantitative accuracy provided by Ga-68 and As-72 for small structures, e.g ., tumor, spleen. table ft1 table-wrap mode="anchored" t5 Table 4. caption a7 Source tissue Source %ID/cc Volume (
Techniques: Modification
Journal: Acta Crystallographica. Section F, Structural Biology Communications
Article Title: Neutron crystallographic study of heterotrimeric glutamine amidotransferase CAB
doi: 10.1107/S2053230X19000220
Figure Lengend Snippet: Macromolecule-production information (Nakamura et al. , 2006 ▸ , 2010 ▸ )
Article Snippet: Macromolecule-production information is given in Table 1 . table ft1 table-wrap mode="anchored" t5 Table 1
Techniques: Clone Assay, Expressing, Plasmid Preparation, Sequencing, Construct, Produced